| 產品名稱 | Aspergillus brasiliensis Varga et al. |
|---|---|
| 商品貨號 | B163483 |
| Deposited As | Aspergillus niger van Tieghem |
| Strain Designations | WLRI 034(120) [CBS 733.88, DSM 1387, DSM 1988, IFO 9455, IMI 149007, NCPF 2275] |
| Application | Assay of antimicrobial preservatives
Media testing
Preparatory test control
Quality control strain
Sterility testing
Testing fungicides
Transformation host
Validation control
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Food testing
Pharmaceutical and Personal Care |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Comments | This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified.
This strain was recently re-named as Aspergillus brasiliensis.
Use of impedance for preservative efficacy testing |
| Morphology | Colonies initially white or yellowish, mycelium growing rapidly producing a dense layer of erect smooth-stiped, conidiophores terminated by globose vesicles bearing phialides (uniseriate) or metulae with phialides (biseriate) which produce dry chains of conidia. Reverse pale to grayish or greenish yellow. Vesicles radiate, initially pale, becoming dark brown to black. Conidia spherical, mid-to-dark brown, highly roughened with ridges and blunt or pointed protuberances, (3-)4-5(-6) μm in diameter. Sporulation may be inhibited when grown in vessels with reduced gas exchange. Colonies may exhibit sectoring with areas of varying levels of sporulation. Use of freshly produced spores as inoculum should reduce sectoring. |
| Medium | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 325: Malt extract agar (Blakeslee's formula) ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S Ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC |
| Name of Depositor | SM Ringel |
| Chain of Custody | ATCC <-- SM Ringel |
| Isolation | Blueberry, North Carolina |
| Cross References | Nucleotide (GenBank) : KU729174 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : FJ195348 ITS including 5.8S rRNA gene |
| References | Connolly P, et al. The use of impedance for preservative efficacy testing of pharmaceuticals and cosmetic products. J. Appl. Bacteriol. 76: 68-74, 1994. PubMed: 8144407 Wnendt S, et al. Molecular cloning, sequence analysis and expression of the gene encoding an antifungal-protein from Aspergillus giganteus. Curr. Genet. 25: 519-523, 1994. PubMed: 8082203 ASTM International Standard Test Method for Preservatives in Water-Containing Cosmetics. West Conshohocken, PA British Pharmacopoeia Commission Test for sterility. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI A, 2003 British Pharmacopoeia Commission Tests for microbial contamination. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI B, 2003 British Pharmacopoeia Commission Efficacy of antimicrobial preservation. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI C, 2003 Wnendt S, et al. Characterization of the gene encoding alpha-sarcin, a ribosome- inactivating protein secreted by Aspergillus giganteus. Gene 124: 239-244, 1993. PubMed: 8444347 Shen LL, et al. DNA topoisomerases from pathogenic fungi: targets for the discovery of antifungal drugs. Antimicrob. Agents Chemother. 36: 2778-2784, 1992. PubMed: 1336349 European Pharmacopoeia Commission Efficacy of antimicrobial preservation. Strasbourg, France:European Pharmacopoeia Commission;European Pharmacopoeia EP 5.1.3, 1997 Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3. U.S. Pharmacopeia General Chapters:<51> ANTIMICROBIAL EFFECTIVENESS TESTING. Rockville, MD:U.S. Pharmacopeia;USP USP34-NF29, 2011 U.S. Pharmacopeia General Chapters: <71> STERILITY TESTS. Rockville, MD:U.S. Pharmacopeia;USP USP34-NF29, 2011 U.S. Pharmacopeia Dietary Supplement Chapters: <2021> Microbial Enumeration Tests-Nutritional and Dietary Supplements. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011 Moreira MT, et alEffect of pulsation on morphology of Aspergillus niger and Phanerochaete chrysosporium in a fluidized-bed reactorIn: Moreira MT, et alImmobilized cells: basics and applicationsAmsterdamElsevierpp. 518-523, 1996 Applied Biosystems, MicroSeq Pharmaceutical Validation Panel. Efficacy of Preservation on Non-Eye Area Water-Miscible Cosmetic and Toiletry Formaulations. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 998.10. Sterility test, Growth promotion test. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.54. Preservatives-effectiveness test. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part II.12. Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003. Cleanrooms and associated controlled environments--Biocontamination control--Part 1: General principles and methods. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14698-1:2003. Ophthalmic optics--Contact lens care products--Antimicrobial preservative efficacy testing and guidance on determining discard date. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14730:2000. Applied Biosystems, MicroSeq PHL Panel. Chemical disinfectants and antiseptics -- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas -- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1650:1998. Chemical disinfectants and antiseptics - Preservation of test organisms used for the determination of bactericidal, sporicidal and fungicidal activity. London, UK:British Standards Institution;British Standard BS EN 12353:2006. Chemical disinfectants and antiseptics --- Quantitative non-porous surface test for the evaluation of bactericidal and/or fungicidal activity of chemical disinfectants used in food, industrial, domestic and institutional areas --- Test method and requirements without mechanical action (phase 2/step 2). London, UK:British Standards Institution;British Standard BS EN 13697:2001. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants for instruments used in the medical area --- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 13624:2003. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of basic fungicidal or basic yeasticidal activity of chemical disinfectants and antiseptics --- Test method and requirements (phase 1). London, UK:British Standards Institution;British Standard BS EN 1275:2005. Chemical disinfectants and antiseptics --- Quantitative carrier test for the evaluation of fungicidal or yeasticidal activity for instruments used in the medical area --- Test method and requirements (phase 2, step 2). London, UK:British Standards Institution;British Standard BS EN 14562:2006. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of fungicidal or yeasticidal activity of chemical disinfectants and antiseptics used in the veterinary area --- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1657:2005. Chemical disinfectants and antiseptics --- Application of European Standards for chemical disinfectants and antiseptics. London, UK:British Standards Institution;British Standard BS EN 14885:2006. Cleanrooms and associated controlled environments --- Biocontamination control --- Part 1: General principles and methods. London, UK:British Standards Institution;British Standard BS EN ISO 14698:2003. Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003. Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007. Houseknecht J, et al. Reclassification of ATCC? 16404 and ATCC? 9642 as Aspergillus brasiliensis. Pharma. Microbiol. Forum Newslett. 14: 2-8, 2008. U.S. Pharmacopeia General Chapters: <1072> Disinfectants and Antiseptics. Rockville, MD. USP34-NF29, 2011 U.S. Pharmacopeia General Chapters: <61> Microbial Examination of Nonsterile Products: Microbial Enumeration Tests. Rockville, MD USP34-NF29, 2011 ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions) Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM. |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
